Full description
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).Lineage
Progress Code: completedNotes
PurposeTo detect krill species in the Southern Ocean from environmental DNA samples.
Data time period: 2019-11-16 to 2019-11-26
text: westlimit=77.2145; southlimit=-68.0036; eastlimit=147.4927; northlimit=-43.2379
User Contributed Tags
Login to tag this record with meaningful keywords to make it easier to discover
Download the dataset. (GET DATA > DIRECT DOWNLOAD)
uri :
https://data.aad.gov.au/eds/5581/download
Public information for AAS project AAS_4556 (PROJECT HOME PAGE)
uri :
https://secure3.aad.gov.au/proms/public/projects/report_project_public.cfm?project_no=AAS_4556
Citation reference for this metadata record and dataset. (VIEW RELATED INFORMATION)
- global : AAS_4556_V1_2019_Euphausiid_raw_sequencing_data