Data

Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples

Australian Ocean Data Network
Suter, L., Wotherspoon, S., Kawaguchi, S., King, R., Macdonald, A., Nester, G., Polanowski, A., Raymond, B. and Deagle, B. ; SUTER, LEONIE ; WOTHERSPOON, SIMON ; KAWAGUCHI, SO ; KING, ROB ; MACDONALD, ANNA ; NESTER, GEORGIA ; POLANOWSKI, ANDREA ; RAYMOND, BEN ; DEAGLE, BRUCE
Viewed: [[ro.stat.viewed]] Cited: [[ro.stat.cited]] Accessed: [[ro.stat.accessed]]
ctx_ver=Z39.88-2004&rft_val_fmt=info%3Aofi%2Ffmt%3Akev%3Amtx%3Adc&rfr_id=info%3Asid%2FANDS&rft_id=Dataset DOI&rft.title=Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples&rft.identifier=Dataset DOI&rft.publisher=Australian Antarctic Data Centre&rft.description=This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).Progress Code: completed&rft.creator=Suter, L., Wotherspoon, S., Kawaguchi, S., King, R., Macdonald, A., Nester, G., Polanowski, A., Raymond, B. and Deagle, B. &rft.creator=SUTER, LEONIE &rft.creator=WOTHERSPOON, SIMON &rft.creator=KAWAGUCHI, SO &rft.creator=KING, ROB &rft.creator=MACDONALD, ANNA &rft.creator=NESTER, GEORGIA &rft.creator=POLANOWSKI, ANDREA &rft.creator=RAYMOND, BEN &rft.creator=DEAGLE, BRUCE &rft.date=2022&rft.coverage=westlimit=77.2145; southlimit=-68.0036; eastlimit=147.4927; northlimit=-43.2379&rft.coverage=westlimit=77.2145; southlimit=-68.0036; eastlimit=147.4927; northlimit=-43.2379&rft_rights=This metadata record is publicly available.&rft_rights=These data are publicly available for download from the provided URL.&rft_rights= https://creativecommons.org/licenses/by/4.0/legalcode&rft_rights=This data set conforms to the CCBY Attribution License (http://creativecommons.org/licenses/by/4.0/). Please follow instructions listed in the citation reference provided at http://data.aad.gov.au/aadc/metadata/citation.cfm?entry_id=AAS_4556_V1_2019_Euphausiid_raw_sequencing_data when using these data. http://creativecommons.org/licenses/by/4.0/).&rft_rights=Portable Network Graphic&rft_rights=https://i.creativecommons.org/l/by/3.0/88x31.png&rft_rights=Creative Commons by Attribution logo&rft_rights=Attribution 4.0 International (CC BY 4.0)&rft_rights=Legal code for Creative Commons by Attribution 4.0 International license&rft_rights=Attribution 4.0 International (CC BY 4.0)&rft_rights= https://creativecommons.org/licenses/by/4.0/legalcode&rft.type=dataset&rft.language=English Access the data
Cite Saved to MyRDA Save to MyRDA

Licence & Rights:

Other view details
Unknown

https://creativecommons.org/licenses/by/4.0/legalcode

This data set conforms to the CCBY Attribution License (http://creativecommons.org/licenses/by/4.0/).

Please follow instructions listed in the citation reference provided at http://data.aad.gov.au/aadc/metadata/citation.cfm?entry_id=AAS_4556_V1_2019_Euphausiid_raw_sequencing_data when using these data.
http://creativecommons.org/licenses/by/4.0/).

Attribution 4.0 International (CC BY 4.0)

https://creativecommons.org/licenses/by/4.0/legalcode

This metadata record is publicly available.

These data are publicly available for download from the provided URL.

Portable Network Graphic

https://i.creativecommons.org/l/by/3.0/88x31.png

Creative Commons by Attribution logo

Attribution 4.0 International (CC BY 4.0)

Legal code for Creative Commons by Attribution 4.0 International license

Access:

Other

Contact Information

metadata@aad.gov.au

Brief description

This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).

Lineage

Progress Code: completed

Notes

Purpose
To detect krill species in the Southern Ocean from environmental DNA samples.

Data time period: 2019-11-16 to 2019-11-26

147.4927,-43.2379 147.4927,-68.0036 77.2145,-68.0036 77.2145,-43.2379 147.4927,-43.2379

112.3536,-55.62075

text: westlimit=77.2145; southlimit=-68.0036; eastlimit=147.4927; northlimit=-43.2379

User Contributed Tags    

Login to tag this record with meaningful keywords to make it easier to discover

Other Information
Download the dataset. (GET DATA > DIRECT DOWNLOAD)

uri : https://data.aad.gov.au/eds/5581/download

Similar data you may be interested in: