Data

Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples

Australian Ocean Data Network
Suter, L., Wotherspoon, S., Kawaguchi, S., King, R., Macdonald, A., Nester, G., Polanowski, A., Raymond, B. and Deagle, B. ; SUTER, LEONIE ; WOTHERSPOON, SIMON ; KAWAGUCHI, SO ; KING, ROB ; MACDONALD, ANNA ; NESTER, GEORGIA ; POLANOWSKI, ANDREA ; RAYMOND, BEN ; DEAGLE, BRUCE
Viewed: [[ro.stat.viewed]] Cited: [[ro.stat.cited]] Accessed: [[ro.stat.accessed]]
ctx_ver=Z39.88-2004&rft_val_fmt=info%3Aofi%2Ffmt%3Akev%3Amtx%3Adc&rfr_id=info%3Asid%2FANDS&rft_id=http://data.aad.gov.au/metadata/records/AAS_4556_V1_2019_Euphausiid_raw_sequencing_data&rft.title=Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples&rft.identifier=http://data.aad.gov.au/metadata/records/AAS_4556_V1_2019_Euphausiid_raw_sequencing_data&rft.publisher=Australian Antarctic Data Centre&rft.description=This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).Progress Code: completed&rft.creator=Suter, L., Wotherspoon, S., Kawaguchi, S., King, R., Macdonald, A., Nester, G., Polanowski, A., Raymond, B. and Deagle, B. &rft.creator=SUTER, LEONIE &rft.creator=WOTHERSPOON, SIMON &rft.creator=KAWAGUCHI, SO &rft.creator=KING, ROB &rft.creator=MACDONALD, ANNA &rft.creator=NESTER, GEORGIA &rft.creator=POLANOWSKI, ANDREA &rft.creator=RAYMOND, BEN &rft.creator=DEAGLE, BRUCE &rft.date=2022&rft.coverage=westlimit=77.2145; southlimit=-68.0036; eastlimit=147.4927; northlimit=-43.2379&rft.coverage=westlimit=77.2145; southlimit=-68.0036; eastlimit=147.4927; northlimit=-43.2379&rft_rights=These data are publicly available for download from the provided URL.&rft_rights=Attribution 4.0 International (CC BY 4.0) https://creativecommons.org/licenses/by/4.0/legalcode&rft_rights=This data set conforms to the CCBY Attribution License (http://creativecommons.org/licenses/by/4.0/). Please follow instructions listed in the citation reference provided at http://data.aad.gov.au/aadc/metadata/citation.cfm?entry_id=AAS_4556_V1_2019_Euphausiid_raw_sequencing_data when using these data.&rft_rights=This metadata record is publicly available.&rft_subject=biota&rft_subject=oceans&rft_subject=EARTH SCIENCE > BIOLOGICAL CLASSIFICATION > ANIMALS/INVERTEBRATES > ARTHROPODS > CRUSTACEANS > EUPHAUSIIDS (KRILL)&rft_subject=METABARCODING&rft_subject=ILLUMINA MISEQ&rft_subject=ADS > Automated DNA Sequencer&rft_subject=LABORATORY > LABORATORY&rft_subject=AMD/AU&rft_subject=AMD&rft_subject=CEOS&rft_subject=OCEAN > SOUTHERN OCEAN&rft_subject=GEOGRAPHIC REGION > POLAR&rft_subject=CONTINENT > ANTARCTICA > DAVIS STATION&rft_subject=CONTINENT > AUSTRALIA/NEW ZEALAND > AUSTRALIA > AUSTRALIA&rft.type=dataset&rft.language=English Access the data

Licence & Rights:

Open Licence view details
CC-BY

Attribution 4.0 International (CC BY 4.0)
https://creativecommons.org/licenses/by/4.0/legalcode

These data are publicly available for download from the provided URL.

This data set conforms to the CCBY Attribution License (http://creativecommons.org/licenses/by/4.0/).

Please follow instructions listed in the citation reference provided at http://data.aad.gov.au/aadc/metadata/citation.cfm?entry_id=AAS_4556_V1_2019_Euphausiid_raw_sequencing_data when using these data.

This metadata record is publicly available.

Access:

Other

Full description

This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).

Lineage

Progress Code: completed

Notes

Purpose
To detect krill species in the Southern Ocean from environmental DNA samples.

Data time period: 2019-11-16 to 2019-11-26

This dataset is part of a larger collection

Click to explore relationships graph

147.4927,-43.2379 147.4927,-68.0036 77.2145,-68.0036 77.2145,-43.2379 147.4927,-43.2379

112.3536,-55.62075

text: westlimit=77.2145; southlimit=-68.0036; eastlimit=147.4927; northlimit=-43.2379

Other Information
Download the dataset. (GET DATA > DIRECT DOWNLOAD)

uri : https://data.aad.gov.au/eds/5581/download

Public information for AAS project AAS_4556 (PROJECT HOME PAGE)

uri : https://secure3.aad.gov.au/proms/public/projects/report_project_public.cfm?project_no=AAS_4556

Citation reference for this metadata record and dataset. (VIEW RELATED INFORMATION)

uri : https://data.aad.gov.au/aadc/metadata/citation.cfm?entry_id=AAS_4556_V1_2019_Euphausiid_raw_sequencing_data

Identifiers
  • global : AAS_4556_V1_2019_Euphausiid_raw_sequencing_data