Data

Pollen metabarcoding at Jerrabomberra wetlands

Commonwealth Scientific and Industrial Research Organisation
Milla, Liz ; Schmidt-Lebuhn, Alexander ; bovill, jessica ; Encinas-Viso, Francisco
Viewed: [[ro.stat.viewed]] Cited: [[ro.stat.cited]] Accessed: [[ro.stat.accessed]]
ctx_ver=Z39.88-2004&rft_val_fmt=info%3Aofi%2Ffmt%3Akev%3Amtx%3Adc&rfr_id=info%3Asid%2FANDS&rft_id=info:doi10.25919/w5qg-c293&rft.title=Pollen metabarcoding at Jerrabomberra wetlands&rft.identifier=https://doi.org/10.25919/w5qg-c293&rft.publisher=Commonwealth Scientific and Industrial Research Organisation&rft.description=Pollen metabarcoding data from honeybee hives at Jerrabomberra wetlands, ACT. Markers used are ITS2 and trnL. Pollen sources are honey, pollen from bee bodies and pollen from pollen traps.\nLineage: DNA was extracted from pollen sources and amplified using primers listed below. Data was sequenced on an Illumina MiSeq using 2x250bp by Ramaciotti Centre for Genomics (UNSW), with funding from BioPlatforms Australia. \nPrimers used are:\nITS2-S2F:ATGCGATACTTGGTGTGAAT, Chen, et al. (2010)\nITS2-4 rev:TCCTCCGCTTATTGATATGC, White, et al. (1990)\ntrnL (UAA) p6 loop-g:GGGCAATCCTGAGCCAA, Baamrane, et al. (2012)\ntrnL (UAA) p6 loop-h:CCATTGAGTCTCTGCACCTATC, White, et al. (1990)\n&rft.creator=Milla, Liz &rft.creator=Schmidt-Lebuhn, Alexander &rft.creator=bovill, jessica &rft.creator=Encinas-Viso, Francisco &rft.date=2021&rft.edition=v3&rft.coverage=westlimit=149.14305555555555; southlimit=-35.32491666666667; eastlimit=149.17291666666665; northlimit=-35.301472222222216; projection=WGS84&rft_rights=Creative Commons Attribution Noncommercial-Share Alike 4.0 Licence https://creativecommons.org/licenses/by-nc-sa/4.0/&rft_rights=Data is accessible online and may be reused in accordance with licence conditions&rft_rights=All Rights (including copyright) CSIRO 2020.&rft_subject=eDNA&rft_subject=pollination&rft_subject=ecology&rft_subject=biomonitoring&rft_subject=Ecological applications not elsewhere classified&rft_subject=Ecological applications&rft_subject=ENVIRONMENTAL SCIENCES&rft_subject=Conservation and biodiversity&rft_subject=Environmental management&rft_subject=Environmental management&rft.type=dataset&rft.language=English Access the data
Cite Saved to MyRDA Save to MyRDA

Licence & Rights:

Non-Commercial Licence view details
CC-BY-NC-SA

Creative Commons Attribution Noncommercial-Share Alike 4.0 Licence
https://creativecommons.org/licenses/by-nc-sa/4.0/

Data is accessible online and may be reused in accordance with licence conditions

All Rights (including copyright) CSIRO 2020.

Access:

Open view details

Accessible for free

Contact Information



Brief description

Pollen metabarcoding data from honeybee hives at Jerrabomberra wetlands, ACT. Markers used are ITS2 and trnL. Pollen sources are honey, pollen from bee bodies and pollen from pollen traps.
Lineage: DNA was extracted from pollen sources and amplified using primers listed below. Data was sequenced on an Illumina MiSeq using 2x250bp by Ramaciotti Centre for Genomics (UNSW), with funding from BioPlatforms Australia.
Primers used are:
ITS2-S2F:ATGCGATACTTGGTGTGAAT, Chen, et al. (2010)
ITS2-4 rev:TCCTCCGCTTATTGATATGC, White, et al. (1990)
trnL (UAA) p6 loop-g:GGGCAATCCTGAGCCAA, Baamrane, et al. (2012)
trnL (UAA) p6 loop-h:CCATTGAGTCTCTGCACCTATC, White, et al. (1990)

Available: 2021-12-07

Data time period: 2018-10-24 to 2018-10-25

This dataset is part of a larger collection

Click to explore relationships graph
Help

Related People

Related Grants and Projects

149.17292,-35.30147 149.17292,-35.32492 149.14306,-35.32492 149.14306,-35.30147 149.17292,-35.30147

149.15798611112,-35.313194444445

Subjects
Conservation and Biodiversity | Environmental Sciences | Ecological Applications | Ecological Applications Not Elsewhere Classified | Environmental Management | Environmental Management | biomonitoring | eDNA | ecology | pollination |

User Contributed Tags    

Login to tag this record with meaningful keywords to make it easier to discover

Identifiers
Similar data you may be interested in: