Full description
Pollen metabarcoding data from honeybee hives at Jerrabomberra wetlands, ACT. Markers used are ITS2 and trnL. Pollen sources are honey, pollen from bee bodies and pollen from pollen traps.Lineage: DNA was extracted from pollen sources and amplified using primers listed below. Data was sequenced on an Illumina MiSeq using 2x250bp by Ramaciotti Centre for Genomics (UNSW), with funding from BioPlatforms Australia.
Primers used are:
ITS2-S2F:ATGCGATACTTGGTGTGAAT, Chen, et al. (2010)
ITS2-4 rev:TCCTCCGCTTATTGATATGC, White, et al. (1990)
trnL (UAA) p6 loop-g:GGGCAATCCTGAGCCAA, Baamrane, et al. (2012)
trnL (UAA) p6 loop-h:CCATTGAGTCTCTGCACCTATC, White, et al. (1990)
Available: 2021-12-07
Data time period: 2018-10-24 to 2018-10-25
Subjects
Conservation and Biodiversity |
Environmental Sciences |
Ecological Applications |
Ecological Applications Not Elsewhere Classified |
Environmental Management |
Environmental Management |
biomonitoring |
eDNA |
ecology |
pollination |
User Contributed Tags
Login to tag this record with meaningful keywords to make it easier to discover
Identifiers
- DOI : 10.25919/W5QG-C293
- Handle : 102.100.100/433133
- URL : data.csiro.au/collection/csiro:43989
