Data

Mullaloo aquifer 16S and 18S rRNA data

Commonwealth Scientific and Industrial Research Organisation
Stephenson, Sarah ; Kaksonen, Anna ; Saccò, Mattia ; Campbell, Matthew ; Greenfield, Paul ; Chariton, Anthony ; Douglas, Grant
Viewed: [[ro.stat.viewed]] Cited: [[ro.stat.cited]] Accessed: [[ro.stat.accessed]]
ctx_ver=Z39.88-2004&rft_val_fmt=info%3Aofi%2Ffmt%3Akev%3Amtx%3Adc&rfr_id=info%3Asid%2FANDS&rft_id=info:doi10.25919/5zp7-kz35&rft.title=Mullaloo aquifer 16S and 18S rRNA data&rft.identifier=10.25919/5zp7-kz35&rft.publisher=Commonwealth Scientific and Industrial Research Organisation (CSIRO)&rft.description=Groundwater samples for eDNA analysis were collected in June 2015 approximately 18 months after the formal commissioning of the Pawsey Centre GWC system located in suburban Perth, Western Australia, in November 2013. DNA was extracted from filtered bore water samples from Production bores and monitoring bores from the Pawsey bores and Water Corporation bores.Groundwater was filtered on 0.1 µm Durapore® membrane filters using a peristaltic pump. Cells were harvested on the on 0.1 µm Durapore® membrane filters and 0.2 g biomass from the filters was used for extracting DNA the Powersoil DNA isolation kit with extended incubation steps and an extra ethanol wash before the final elution in 100 µL of C6 (elution buffer). DNA samples were amplified using EMP 16S rRNA primers to analyse bacteria communities and EMP 18S v4 rRNA primers for eukaryote community analysis. Bacterial and archaeal 16S rRNA genes were amplified using the standard Earth Microbiome project (EMP) 16S Illumina amplicon protocol (http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/16s/) with primers: 515F (GTGCCAGCMGCCGCGGTAA) and 806R (GGACTACHVGGGTWTCTAAT) (Caporaso et al., 2011). Eukaryotic 18S rRNA genes were amplified using EMP 18S Illumina amplicon protocol (http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/18s/) with primers Euk_1391f (GTACACACCGCCCGTC) and EukBr (TGATCCTTCTGCAGGTTCACCTAC) (Amaral-Zettler et al. 2009). Amplicon libraries were prepared with Illumina Nextera kit. Next generation sequencing (NGS) was carried out using the Illumina MiSeq platform (Illumina, Inc., San Diego, USA), 2x250 bp with paired reads, and performed according to manufacturer’s directions at the Ramaciotti Centre for Genomics (UNSW Sydney, Australia). The 18S and 16S rRNA gene sequence data were processed using a custom pipeline Greenfield Hybrid Amplicon Pipeline (GHAP) which is based around USEARCH tools (Edgar, 2013).&rft.creator=Stephenson, Sarah &rft.creator=Kaksonen, Anna &rft.creator=Saccò, Mattia &rft.creator=Campbell, Matthew &rft.creator=Greenfield, Paul &rft.creator=Chariton, Anthony &rft.creator=Douglas, Grant &rft.date=2022&rft.edition=v1&rft.coverage=north=-31.994; east=115.883; projection=WGS84&rft_rights=All Rights (including copyright) CSIRO 2022.&rft_rights=Creative Commons Attribution-Noncommercial https://creativecommons.org/licenses/by-nc/4.0/&rft_subject=Amplicons&rft_subject=aquifer&rft_subject=prokaryotes&rft_subject=eukaryotes&rft_subject=groundwater&rft_subject=Genomics&rft_subject=BIOLOGICAL SCIENCES&rft_subject=GENETICS&rft_subject=Freshwater Ecology&rft_subject=ECOLOGY&rft_subject=Environmental Monitoring&rft_subject=ENVIRONMENTAL SCIENCES&rft_subject=ENVIRONMENTAL SCIENCE AND MANAGEMENT&rft_subject=Microbial Genetics&rft_subject=MICROBIOLOGY&rft_subject=Molecular Targets&rft_subject=MEDICAL AND HEALTH SCIENCES&rft_subject=ONCOLOGY AND CARCINOGENESIS&rft.type=dataset&rft.language=English Access the data
Cite Saved to MyRDA Save to MyRDA

Licence & Rights:

Non-Commercial Licence view details
CC-BY-NC

Creative Commons Attribution-Noncommercial
https://creativecommons.org/licenses/by-nc/4.0/

All Rights (including copyright) CSIRO 2022.

Access:

Open view details

Data is accessible online and may be reused in accordance with licence conditions

Brief description

Groundwater samples for eDNA analysis were collected in June 2015 approximately 18 months after the formal commissioning of the Pawsey Centre GWC system located in suburban Perth, Western Australia, in November 2013. DNA was extracted from filtered bore water samples from Production bores and monitoring bores from the Pawsey bores and Water Corporation bores.

Lineage

Groundwater was filtered on 0.1 µm Durapore® membrane filters using a peristaltic pump. Cells were harvested on the on 0.1 µm Durapore® membrane filters and 0.2 g biomass from the filters was used for extracting DNA the Powersoil DNA isolation kit with extended incubation steps and an extra ethanol wash before the final elution in 100 µL of C6 (elution buffer). DNA samples were amplified using EMP 16S rRNA primers to analyse bacteria communities and EMP 18S v4 rRNA primers for eukaryote community analysis. Bacterial and archaeal 16S rRNA genes were amplified using the standard Earth Microbiome project (EMP) 16S Illumina amplicon protocol (http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/16s/) with primers: 515F (GTGCCAGCMGCCGCGGTAA) and 806R (GGACTACHVGGGTWTCTAAT) (Caporaso et al., 2011). Eukaryotic 18S rRNA genes were amplified using EMP 18S Illumina amplicon protocol (http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/18s/) with primers Euk_1391f (GTACACACCGCCCGTC) and EukBr (TGATCCTTCTGCAGGTTCACCTAC) (Amaral-Zettler et al. 2009). Amplicon libraries were prepared with Illumina Nextera kit. Next generation sequencing (NGS) was carried out using the Illumina MiSeq platform (Illumina, Inc., San Diego, USA), 2x250 bp with paired reads, and performed according to manufacturer’s directions at the Ramaciotti Centre for Genomics (UNSW Sydney, Australia). The 18S and 16S rRNA gene sequence data were processed using a custom pipeline Greenfield Hybrid Amplicon Pipeline (GHAP) which is based around USEARCH tools (Edgar, 2013).

Data time period: 2015-06-01 to 2015-06-30

This dataset is part of a larger collection

Click to explore relationships graph
Help

Related Organisations

  • Managed by, Associated with CSIRO

Related People

115.883,-31.994

115.883,-31.994

dcmiPoint: north=-31.994; east=115.883; projection=WGS84

Subjects
Amplicons | Biological Sciences | Ecology | Environmental Science and Management | Environmental Sciences | Environmental Monitoring | Freshwater Ecology | Genetics | Genomics | Medical and Health Sciences | Microbiology | Microbial Genetics | Molecular Targets | Oncology and Carcinogenesis | aquifer | eukaryotes | groundwater | prokaryotes |

User Contributed Tags    

Login to tag this record with meaningful keywords to make it easier to discover

Identifiers
Similar data you may be interested in: